Thursday, May 21, 2009

SWINE FLU.......a H1N1 virus flow

SWINE FLU, a type of influenza, caused by influenza A virus strain H1N1.
SWINE FLU, a type of influenza, caused by influenza A virus strain H1N1. Like people, pigs can get influenza (flu), but swine flu viruses aren't the same as human flu viruses. Swine flu doesn't often infect people, and the rare human cases that have occurred in the past have mainly affected people who had direct contact with pigs. But the current swine flu outbreak is different. It's caused by a new swine flu virus that has changed in ways that allow it to spread from person to person -- and it's happening among people who haven't had any contact with pigs. Most of us are familiar with the structure and genetics of influenza A virus.


Let’s have a brief description,
The physical structure of all influenza A viruses is similar. The virions or virus particles are enveloped and can be either spherical or filamentous in form. In clinical isolates that have undergone limited passages in eggs or tissue culture, there are more filamentous than spherical particles, whereas passaged laboratory strains consist mainly of spherical virions. The Influenza A virus genome is contained on eight single (non-paired) RNA strands that code for eleven proteins (HA, NA, NP, M1, M2, NS1, NEP, PA, PB1, PB1-F2, PB2). The total genome size is 13,588 bases. The segmented nature of the genome allows for the exchange of entire genes between different viral strains during cellular cohabitation.
The eight RNA segments are:


  • HA encodes hemagglutinin (about 500 molecules of hemagglutinin are needed to make one virion).
  • NA encodes neuraminidase (about 100 molecules of neuraminidase are needed to make one virion).
  • NP encodes nucleoprotein.
  • M encodes two matrix proteins (the M1 and the M2) by using different reading frames from the same RNA segment (about 3000 matrix protein molecules are needed to make one virion).
  • NS encodes two distinct non-structural proteins (NS1 and NEP) by using different reading frames from the same RNA segment.
  • PA encodes an RNA polymerase.
  • PB1 encodes an RNA polymerase and PB1-F2 protein (induces apoptosis) by using different reading frames from the same RNA segment.
  • PB2 encodes an RNA polymerase.

The genome segments have common terminal sequences, and the ends of the RNA strands are partially complementary, allowing them to bond to each other by hydrogen bonds. After transcription from negative-sense to positive-sense RNA the +RNA strands get the cellular 5' cap added by cap snatching, which involves the viral protein NS1 binding to the cellular pre-mRNAs. The cap is then cleaved from the cellular pre-mRNA using a second viral protein, PB2. The short oligo cap is then added to the influenza +RNA strands, allowing its processing as messenger RNA by ribosomes. The +RNA strands also serve for synthesis of -RNA strands for new virions.
The RNA synthesis and its assembly with the nucleoprotein takes place in the cell nucleus, the synthesis of proteins takes place in the cytoplasm. The assembled virion cores leave the nucleus and migrate towards the cell membrane, with patches of viral transmembrane proteins (hemagglutinin, neuraminidase and M2 proteins) and an underlying layer of the M1 protein, and bud through these patches, releasing finished enveloped viruses into the extracellular fluid.

I am working on to have a vaccine or drug for this virus. I have figured out many facts about this swine virus and will be discussing them with u all, through my blog.

Now, this was a bit about influenza A virus, now as we know about many of the things, we should proceed further.
From the past many years, RNA segment NA and segment HA were the most targeted segments by the drug discoverers. And I tell u why,
NA encodes neuraminidase, Neuraminidase enzymes are glycoside hydrolase enzymes which cleave the glycosidic linkages of neuraminic acid. Neuraminidase enzymes are a large family, found in a range of organisms. The most commonly known neuraminidase is the viral neuraminidase, a drug target for the prevention of influenza infection. The viral neuraminidases are frequently used as an antigenic determinants found on the surface of the Influenza virus. Some variants of the influenza neuraminidase confer more virulence to the virus than others. Other homologs are found in mammalian cells which have a range of functions. At least four mammalian sialidase homologs have been described in the human genome (see NEU1, NEU2, NEU3, NEU4).
Neuraminidases, also called sialidases, catalyze the hydrolysis of terminal sialic acid residues from the newly formed virions and from the host cell receptors. Sialidase activities include assistance in the mobility of virus particles through the respiratory tract mucus and in the elution of virion progeny from the infected cell.

Enzymatic mechanism of influenza virus sialidase
The enzymatic mechanism of influenza virus sialidase has been studied by Taylor and coworkers. The enzyme catalysis process includes four steps. The first step involves the distortion of the α-sialoside from a 2C5 chair conformer to a boat conformer when the sialoside binds to the sialidase. The second step leads to an oxocarbocation ion intermediate, the sialosyl cation. The third step is the formation and the last step affords α-Neu5Ac then it mutarotates to the more favourable anomer β-Neu5Ac.

Subtypes
Swiss-Prot lists 137 types of neuraminidase from various species as of October 18, 2006. Nine subtypes of influenza neuraminidase are known; many occur only in various species of duck and chicken. Subtypes N1 and N2 have been positively linked to epidemics in man, and strains with N3 or N7 subtypes have been identified in a number of isolated deaths.

Structure
Influenza neuraminidase exists as a mushroom-shape projection on the surface of the influenza virus. It has a head consisting of four co-planar and roughly spherical subunits, and a hydrophobic region that is embedded within the interior of the virus' membrane. It comprises a single polypeptide chain that is oriented in the opposite direction to the hemagglutinin antigen. The composition of the polypeptide is a single chain of six conserved polar amino acids, followed by hydrophilic, variable amino acids.

Inhibitors
Neuraminidase inhibitors are a class of antiviral drugs targeted at the influenza viruses whose mode of action consists of blocking the function of the viral neuraminidase protein, thus preventing the virus from budding from the host cell (reproducing). Neuraminidase inhibitors are useful for combating influenza infection: zanamivir, administered by inhalation; oseltamivir, administered orally; and under research is peramivir administered parenterally, that is through intravenous or intramuscular injection.
There are two major proteins on the surface of influenza virus particles. One is the lectin haemagglutinin protein with three relatively shallow sialic acid-binding sites and the other is enzyme sialidase with the active site in a pocket. Because of the relative deep active site in which low molecular weight inhibitors can make multiple favorable interactions and approachable methods of designing transition state analogues in the hydrolysis of sialosides, the sialidase becomes more attractive anti-influenza drug target than the haemagglutinin. After the X-ray crystal structures of several influenza virus sialidases were available, the structure-based inhibitor design was applied to discover potent inhibitors of this enzyme.

The unsaturated sialic acid (N-acetylneuraminic acid [Neu5ac]) derivative 2-deoxy-2, 3-didehydro-D-N-acetylneuraminic acid (Neu5Ac2en), a sialosyl cation transition-state analogue, is believed the most potent inhibitor core template. To prepare structurally modified Neu5Ac2en derivatives may give more effective inhibitors.
Many Neu5Ac2en-based compounds have been synthesized and tested for their influenza virus sialidase inhibitory potential. For example: The 4-substituted Neu5Ac2en derivatives, 4-amino-Neu5Ac2en (Compound 1), which showed two orders of magnitude better inhibition of influenza virus sialidase than Neu5Ac2en5 and 4-guanidino-Neu5Ac2en (Compound 2), known as Zanamivir, which is now marketed for treatment of influenza virus as a drug, have been designed by von Itzstein and coworkers. A series of amide-linked C9 modified Neu5Ac2en have been reported by Megesh and colleagues as NEU1 inhibitors.
This was all about Neuraminidase in general, now, as this blog evaluate the facts in bioinformaticians view I must take you to the world of bioinformatics, first you should know the genetic structure of the gene NA that encodes for Neuraminidase, so here it is:

TTAAAATGAATCCAAACCAAAAGATAATAACCATTGGTTCGGTCTGTATGACAATTGGAATGGCTAACTTAATATTACAAATTGGAAACATAATCTCAATATGGATTAGCCACTCAATTCAACTTGGGAATCAAAATCAGATTGAAACATGCAATCAAAGCGTCATTACTTATGAAAACAACACTTGGGTAAATCAGACATATGTTAACATCAGCAACACCAACTTTGCTGCTGGACAGTCAGTGGTTTCCGTGAAATTAGCGGGCAATTCCTCTCTCTGCCCTGTTAGTGGATGGGCTATATACAGTAAAGACAACAGTATAAGAATCGGTTCCAAGGGGGATGTGTTTGTCATAAGGGAACCATTCATATCATGCTCCCCCTTGGAATGCAGAACCTTCTTCTTGACTCAAGGGGCCTTGCTAAATGACAAACATTCCAATGGAACCATTAAAGACAGGAGCCCATATCGAACCCTAATGAGCTGTCCTATTGGTGAAGTTCCCTCTCCATACAACTCAAGATTTGAGTCAGTCGCTTGGTCAGCAAGTGCTTGTCATGATGGCATCAATTGGCTAACAATTGGAATTTCTGGCCCAGACAATGGGGCAGTGGCTGTGTTAAAGTACAACGGCATAATAACAGACACTATCAAGAGTTGGAGAAACAATATATTGAGAACACAAGAGTCTGAATGTGCATGTGTAAATGGTTCTTGCTTTACTGTAATGACCGATGGACCAAGTGATGGACAGGCCTCATACAAGATCTTCAGAATAGAAAAGGGAAAGATAGTCAAATCAGTCGAAATGAATGCCCCTAATTATCACTATGAGGAATGCTCCTGTTATCCTGATTCTAGTGAAATCACATGTGTGTGCAGGGATAACTGGCATGGCTCGAATCGACCGTGGGTGTCTTTCAACCAGAATCTGGAATATCAGATAGGATACATATGCAGTGGGATTTTCGGAGACAATCCACGCCCTAATGATAAGACAGGCAGTTGTGGTCCAGTATCGTCTAATGGAGCAAATGGAGTAAAAGGATTTTCATTCAAATACGGCAATGGTGTTTGGATAGGGAGAACTAAAAGCATTAGTTCAAGAAACGGTTTTGAGATGATTTGGGATCCGAACGGATGGACTGGGACAGACAATAACTTCTCAATAAAGCAAGATATCGTAGGAATAAATGAGTGGTCAGGATATAGCGGGAGTTTTGTTCAGCATCCAGAACTAACAGGGCTGGATTGTATAAGACCTTGCTTCTGGGTTGAACTAATCAGAGGGCGACCCAAAGAGAACACAATCTGGACTAGCGGGAGCAGCATATCCTTTTGTGGTGTAAACAGTGACACTGTGGGTTGGTCTTGGCCAGACGGTGCTGAGTTGCCATTTACCATTGACAAGTAATTTGTTC”
This is a complete cds of Neuraminidase gene and after translation this seems to be like:

MNPNQKIITIGSVCMTIGMANLILQIGNIISIWISHSIQLGNQNQIETCNQSVITYENNTWVNQTYVNISNTNFAAGQSVVSVKLAGNSSLCPVSGWAIYSKDNSIRIGSKGDVFVIREPFISCSPLECRTFFLTQGALLNDKHSNGTIKDRSPYRTLMSCPIGEVPSPYNSRFESVAWSASACHDGINWLTIGISGPDNGAVAVLKYNGIITDTIKSWRNNILRTQESECACVNGSCFTVMTDGPSDGQASYKIFRIEKGKIVKSVEMNAPNYHYEECSCYPDSSEITCVCRDNWHGSNRPWVSFNQNLEYQIGYICSGIFGDNPRPNDKTGSCGPVSSNGANGVKGFSFKYGNGVWIGRTKSISSRNGFEMIWDPNGWTGTDNNFSIKQDIVGINEWSGYSGSFVQHPELTGLDCIRPCFWVELIRGRPKENTIWTSGSSISFCGVNSDTVGWSWPDGAELPFTIDK”
This linear sequence of amino acids will take a 3D conformation and will show its effect on the downstream components.
Now a bioinformatician will use certain tools and techniques to discover its active site or the binding site so as to block it. The complete process is a bit typical and every bioinformatician use their own ways to play with the molecule, as am not working on the gene, I could not furnish the process and so, I just introduced you to the gene and its structure.

There is another very important segment of this virus which is HA, that encodes for Hemagglutinin. The extent of infection into host organism is determined by HA. Influenza viruses bud from the apical surface of polarized epithelial cells (e.g. bronchial epithelial cells) into lumen of lungs and are therefore usually pneumotropic. The reason is that HA is cleaved by tryptase clara which is restricted to lungs. However HAs of H5 and H7 pantropic avian viruses subtypes can be cleaved by furin and subtilisin-type enzymes, allowing the virus to grow in other organs than lungs.
Influenza hemagglutinin (HA) or haemagglutinin is a type of hemagglutinin found on the surface of the influenza viruses. It is an antigenic glycoprotein. It is responsible for binding the virus to the cell that is being infected.
The name "hemagglutinin" comes from the protein's ability to cause red blood cells (erythrocytes) to clump together ("agglutinate") in vitro.

Subtypes
There are at least 16 different HA antigens. These subtypes are labeled H1 through H16. The last, H16, was discovered only recently on influenza A viruses isolated from black-headed gulls from Sweden and Norway. The first three hemagglutinins, H1, H2, and H3, are found in human influenza viruses.
A highly pathogenic avian flu virus of H5N1 type has been found to infect humans at a low rate. It has been reported that single amino acid changes in this avian virus strain's type H5 hemagglutinin have been found in human patients that "can significantly alter receptor specificity of avian H5N1 viruses, providing them with an ability to bind to receptors optimal for human influenza viruses". This finding seems to explain how an H5N1 virus that normally does not infect humans can mutate and become able to efficiently infect human cells. The hemagglutinin of the H5N1 virus has been associated with the high pathogenicity of this flu virus strain, apparently due to its ease of conversion to an active form by proteolysis.

Functions and mechanisms of action
HA have two primary functions:
  1. allowing the recognition of target vertebrate cells, accomplished through the binding of these cells' sialic acid-containing receptors, and

  2. Allowing the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.

Mechanism
HA binds to the monosaccharide sialic acid which is present on the surface of its target cells. This causes the viral particles to stick to the cell's surface. The cell membrane then engulfs the virus and the portion of the membrane that encloses it pinches off to form a new membrane-bound compartment within the cell called an endosome, which contains the engulfed virus. The cell then attempts to begin digesting the contents of the endosome by acidifying its interior and transforming it into a lysosome. However, as soon as the pH within the endosome drops to about 6.0, the original folded structure of the HA molecule becomes unstable, causing it to partially unfold, and releasing a very hydrophobic portion of its peptide chain that was previously hidden within the protein. This so-called "fusion peptide" acts like a molecular grappling hook by inserting itself into the endosomal membrane and locking on. Then, when the rest of the HA molecule refolds into a new structure (which is more stable at the lower pH), it "retracts the grappling hook" and pulls the endosomal membrane right up next to the virus particle's own membrane, causing the two to fuse together. Once this has happened, the contents of the virus, including its RNA genome, are free to pour out into the cell's cytoplasm.

Structure
HA is a homotrimeric integral membrane glycoprotein. It is shaped like a cylinder, and is approximately 13.5nm long. The three identical monomers that constitute HA are constructed into a central α helix coil; three spherical heads contain the sialic acid binding sites. HA monomers are synthesized as precursors that are then glycosylated and cleaved into two smaller polypeptides: the HA1 and HA2 subunits. Each HA monomer consists of a long, helical chain anchored in the membrane by HA2 and topped by a large HA1 globule.
Now you should know the genetic framework of this gene as well, so here it is:
AAAACAAAAGCAACAAAAATGAAGGCAATACTAGTAGTTCTGCTATATACATTTGCAACCGCAAATGCAGACACATTATGTATAGGTTATCATGCGAACAATTCAACAGACACTGTAGACACAGTACTAGAAAAGAATGTAACAGTAACACACTCTGTTAACCTTCTAGAAGACAAGCATAACGGGAAACTATGCAAACTAAGAGGGGTAGCCCCATTGCATTTGGGTAAATGTAACATTGCTGGCTGGATCCTGGGAAATCCAGAGTGTGAATCACTCTCCACAGCAAGCTCATGGTCCTACATTGTGGAAACATCTAGTTCAGACAAGGGAACGTGTTACCCAGGAGATTTCATCGATTATGAGGAGCTAAGAGAGCAATTGAGCTCAGTGTCATCATTTGAAAGGTTTGAGATATTCCCCAAGACAAGTTCATGGCCCAATCATGACTCGAACAAAGGTGTAACGGCAGCATGTCCTCATGCTGGAGCAAAAAGCTTCTACAAAAATTTAATATGGCTAGTTAAAAAAGGAAATTCATACCCAAAGCTCAGCAAATCCTACATTAATGATAAAGGGAAAGAAGTCCTCGTGCTATGGGGCATTCACCATCCATCTACTAGTGCTGACCAACAAAGTCTCTATCAGAATGCAGATGCATATGTTTTTGTGGGGACATCAAGATACAGCAAGAAGTTCAAGCCGGAAATAGCAATAAGACCCAAAGTGAGGGATCAAGAAGGGAGAATGAACTATTACTGGACACTAGTAGAGCCGGGAGACAAAATAACATTCGAAGCAACTGGAAATCTAGTGGTACCGAGATATGCATTCGCAATGGAAAGAAATGCTGGATCTGGTATTATCATTTCAGATACACCAGTCCACGATTGCAATACAACTTGTCAGACACCCAAGGGTGCTATAAACACCAGCCTCCCATTTCAGAATATACATCCGATCACAATTGGAAAATGTCCAAAATATGTAAAAAGCACAAAATTGAGACTGGCCACAGGATTGAGGAATGTCCCGTCTATTCAATCTAGAGGCCTATTTGGGGCCATTGCCGGTTTCATTGAAGGGGGGTGGACAGGGATGGTAGATGGATGGTACGGTTATCACCATCAAAATGAGCAGGGGTCAGGATATGCAGCCGACCTGAAGAGCACACAGAATGCCATTGACGAGATTACTAACAAAGTAAATTCTGTTATTGAAAAGATGAATACACAGTTCACAGCAGTAGGTAAAGAGTTCAACCACCTGGAAAAAAGAATAGAGAATTTAAATAAAAAAGTTGATGATGGTTTCCTGGACATTTGGACTTACAATGCCGAACTGTTGGTTCTATTGGAAAATGAAAGAACTTTGGACTACCACGATTCAAATGTGAAGAACTTATATGAAAAGGTAAGAAGCCAGTTAAAAAACAATGCCAAGGAAATTGGAAACGGCTGCTTTGAATTTTACCACAAATGCGATAACACGTGCATGGAAAGTGTCAAAAATGGGACTTATGACTACCCAAAATACTCAGAGGAAGCAAAATTAAACAGAGAAGAAATAGATGGGGTAAAGCTGGAATCAACAAGGATTTACCAGATTTTGGCGATCTATTCAACTGTCGCCAGTTCATTGGTACTGGTAGTCTCCCTGGGGGCAATCAGTTTCTGGATGTGCTCTAATGGGTCTCTACAGTGTAGAATATGTATTTAACATTAGGATTTCAGAAGCATGAGA”
And when it got translated its look like:

MKAILVVLLYTFATANADTLCIGYHANNSTDTVDTVLEKNVTVTHSVNLLEDKHNGKLCKLRGVAPLHLGKCNIAGWILGNPECESLSTASSWSYIVETSSSDKGTCYPGDFIDYEELREQLSSVSSFERFEIFPKTSSWPNHDSNKGVTAACPHAGAKSFYKNLIWLVKKGNSYPKLSKSYINDKGKEVLVLWGIHHPSTSADQQSLYQNADAYVFVGTSRYSKKFKPEIAIRPKVRDQEGRMNYYWTLVEPGDKITFEATGNLVVPRYAFAMERNAGSGIIISDTPVHDCNTTCQTPKGAINTSLPFQNIHPITIGKCPKYVKSTKLRLATGLRNVPSIQSRGLFGAIAGFIEGGWTGMVDGWYGYHHQNEQGSGYAADLKSTQNAIDEITNKVNSVIEKMNTQFTAVGKEFNHLEKRIENLNKKVDDGFLDIWTYNAELLVLLENERTLDYHDSNVKNLYEKVRSQLKNNAKEIGNGCFEFYHKCDNTCMESVKNGTYDYPKYSEEAKLNREEIDGVKLESTRIYQILAIYSTVASSLVLVVSLGAISFWMCSNGSLQCRICI”
This is the initial phase of understanding a molecule by any bioinformatician, and after getting the sequence he can start his mechanics. HA segment is not the segment I m concerned with.

Now, lets move to the region or a segment of influenza A virus strain H1N1 which could help me and many researchers all over the world to tackle with the disease.
The segment is PA segment which encodes for RNA polymerase, but before moving to its genetic content, you all must know how it is essential for us.
When the influenza virus infects a host cell its goal is to produce many copies of itself that go on to attack even more cells. A viral enzyme, called polymerase, is key to this process. It both copies the genetic material of the virus and steers the host cell machinery towards the synthesis of viral proteins. It does this by stealing a small tag, called a cap, from host cell RNA molecules and adding it onto its own. The cap is a short extra piece of RNA, which must be present at the beginning of all messenger RNAs (mRNAs) to direct the cell's protein-synthesis machinery to the starting point. The viral polymerase binds to host cell mRNA via its cap, cuts the cap off and adds it to the beginning of its own mRNA – a process known as 'cap snatching'. But exactly how the polymerase achieves this and which of the three subunits of the enzyme does what, has remained controversial.
There is another segment i.e. PB2 which encodes for RNA polymerase but its function a different from the polymerase encoded by segment PA.
I am focusing on segment PA, so as to block its function of removing cap from the host cell’s mRNA.
To start with, I must know the genetic framework of the gene, so for the purpose I retrieved the sequence from Genebank – a well known database of NCBI, which is as follows:
ATGGAAGACTTTGTGCGACAATGCTTCAATCCAATGATCGTCGAGCTTGCGGAAAAGGCAATGAAAGAATATGGGGAAGATCCGAAAATCGAAACTAACAAGTTTGCTGCAATATGCACACATTTGGAAGTTTGTTTCATGTATTCGGATTTCCATTTCATCGACGAACGGGGTGAATCAATAATTGTAGAATCTGGTGACCCGAATGCACTATTGAAGCACCGATTTGAGATAATTGAAGGAAGAGACCGAATCATGGCCTGGACAGTGGTGAACAGTATATGTAACACAACAGGGGTAGAGAAGCCTAAATTTCTTCCTGATTTGTATGATTACAAAGAGAACCGGTTCATTGAAATTGGAGTAACACGGAGGGAAGTCCACATATATTACCTAGAGAAAGCCAACAAAATAAAATCTGAGAAGACACACATTCACATCTTTTCATTCACTGGAGAGGAGATGGCCACCAAAGCGGACTACACCCTTGACGAAGAGAGCAGGGCAAGAATCAAAACTAGGCTTTTCACTATAAGACAAGAAATGGCCAGTAGGAGTCTATGGGATTCCTTTCGTCAGTCCGAAAGAGGCGAAGAGACAATTGAAGAAAAATTTGAGATTACAGGAACTATGCGCAAGCTTGCCGACCAAAGTCTCCCACCGAACTTCTCCAGCCTTGAAAACTTTAGAGCCTATGTAGATGGATTCGAGCCGAACGGTTGCATTGAGGGCAAGCTTTCCCAAATGTCAAAAGAAGTGAACGCCAAAATTGAACCATTCTTGAGGACGACACCACGCCCCCTCAGATTGCCTGATGGGCCTCTTTGCCATCAGCGGTCAAAGTTCCTGCTGATGGATGCTCTGAAATTAAGTATTGAAGACCCAAGTCACGAGGGGGAGGGAATACCACTATATGATGCAATCAAATGCATGAAGACATTCTTTGGCTGGAAAGAGCCTAACATAGTCAAACCACATGAGAAAGGCATAAATCCCAATTACCTCATGGCTTGGAAGCAGGTGCTAGCAGAGCTACAGGACATTGAAAATGAAGAGAAGATCCCAAGGACAAAGAACATGAAGAGAACAAGCCAATTGAAGTGGGCACTCGGTGAAAATATGGCACCAGAAAAAGTAGACTTTGATGACTGCAAAGATGTTGGAGACCTTAAACAGTATGACAGTGATGAGCCAGAGCCCAGATCTCTAGCAAGCTGGGTCCAAAATGAATTCAATAAGGCATGTGAATTGACTGATTCAAGCTGGATAGAACTTGATGAAATAGGAGAAGATGTTGCCCCGATTGAACATATCGCAAGCATGAGGAGGAACTATTTTACAGCAGAAGTGTCCCACTGCAGGGCTACTGAATACATAATGAAGGGAGTGTACATAAATACGGCCTTGCTCAATGCATCCTGTGCAGCCATGGATGACTTTCAGCTGATCCCAATGATAAGCAAATGTAGGACCAAAGAAGGAAGACGGAAAACAAACCTGTATGGGTTCATTATAAAAGGAAGGTCTCATTTGAGAAATGATACTGATGTGGTGAACTTTGTAAGTATGGAGTTCTCACTCACTGACCCGAGACTGGAGCCACACAAATGGGAAAAATACTGTGTTCTTGAAATAGGAGACATGCTCTTGAGGACTGCGATAGGCCAAGTGTCGAGGCCCATGTTCCTATATGTGAGAACCAATGGAACCTCCAAGATCAAGATGAAATGGGGCATGGAAATGAGGCGCTGCCTTCTTCAGTCTCTTCAGCAGATTGAGAGCATGATTGAGGCCGAGTCTTCTGTCAAAGAGAAAGACATGACCAAGGAATTCTTTGAAAACAAATCGGAAACATGGCCAATCGGAGAGTCACCCAGGGGAGTGGAGGAAGGCTCTATTGGGAAAGTGTGCAGGACCTTACTGGCAAAATCTGTATTCAACAGTCTATATGCGTCTCCACAACTTGAGGGGTTTTCGGCTGAATCGAGAAAATTGCTTCTCATTGTTCAGGCACTTAGGGACAACCTGGAACCTGGAACCTTCGATCTTGGGGGGCTATATGAAGCAATCGAGGAGTGCCTGATTAATGATCCCTGGGTTTTGCTTAATGCATCTTGGTTCAACTCCTTCCTCACACATGCACTGAAGTAG”
This gene is translated to:

MEDFVRQCFNPMIVELAEKAMKEYGEDPKIETNKFAAICTHLEVCFMYSDFHFIDERGESIIVESGDPNALLKHRFEIIEGRDRIMAWTVVNSICNTTGVEKPKFLPDLYDYKENRFIEIGVTRREVHIYYLEKANKIKSEKTHIHIFSFTGEEMATKADYTLDEESRARIKTRLFTIRQEMASRSLWDSFRQSERGEETIEEKFEITGTMRKLADQSLPPNFSSLENFRAYVDGFEPNGCIEGKLSQMSKEVNAKIEPFLRTTPRPLRLPDGPLCHQRSKFLLMDALKLSIEDPSHEGEGIPLYDAIKCMKTFFGWKEPNIVKPHEKGINPNYLMAWKQVLAELQDIENEEKIPRTKNMKRTSQLKWALGENMAPEKVDFDDCKDVGDLKQYDSDEPEPRSLASWVQNEFNKACELTDSSWIELDEIGEDVAPIEHIASMRRNYFTAEVSHCRATEYIMKGVYINTALLNASCAAMDDFQLIPMISKCRTKEGRRKTNLYGFIIKGRSHLRNDTDVVNFVSMEFSLTDPRLEPHKWEKYCVLEIGDMLLRTAIGQVSRPMFLYVRTNGTSKIKMKWGMEMRRCLLQSLQQIESMIEAESSVKEKDMTKEFFENKSETWPIGESPRGVEEGSIGKVCRTLLAKSVFNSLYASPQLEGFSAESRKLLLIVQALRDNLEPGTFDLGGLYEAIEECLINDPWVLLNASWFNSFLTHALK

The strains of viruses change themselves by Antigenic Shift and Antigenic Drift.
Antigenic drift creates influenza viruses with slightly modified antigens - while antigenic shift generates viruses with entirely novel antigens. The H1N1 virus that usually infects the swine is a bit different from the H1N1 virus that causes Swine flu in Humans. Antigenic Drift is the continuous process of genetic and antigenic change among flu strains.
When I had taken sequences of H1N1 virus from a swine sample and H1N1 virus from Human Sample and performed MSA (multiple sequence alignment) using “ClustalW”, the results were same as I had calculated, there were certain mutation in RNA polymerase encoded by segment PA as well. So if I would have developed any molecule that can bind with the RNA polymerase to slow down its function for H1N1 virus which causes Swine Flu in Swines, it might not be efficient for the Swine Flu in Humans. So there are certain mutations in H1N1-human strain by the process called antigenic drift.

Now proceeding further, I will first reconstruct its structure so to have a deep look for its active side and binding sites. This will be a bit tedious task but a process of HOMOLOGY MODELLING will help me.

on the basis of work on 23-may-2009, it is found that the structure of H1N1, that causes Swine Flu is having only single chain i.e. Chain "A" but, the H1N1 virus that causes Swine Flu in Swine(Pigs) were having two chains i.e. Chain "A" & Chain "B".
a new and effective finding, thatz based on the work, m pursuing, is about the structural proteomics of "PA" segment of H1N1 strain that causes Swine Flu in Humans, its sequence in Human H1N1 strain, is a hybrid of H1N1 (found in swine) and a H5N1 (found in avains). The sequence evident, i'll be displaying soon.


After so much work onto the sequence i have, i finally able to develop a most probable structure of the polymerase that helps in cap snatching i.e PA-polymerase and following are some images of the same.

The day when i sat to built its structure, i thought it will be impossible to do it, but by my skills an god grace i got success. To built its structure i used a protocol and some algorithm, developed my me, and it took many days to get the full structure. i'll be giving all the information soon but if u really in hurry jst mail me on achal13rastogi@gmail.com.

This was all I have discovered yet, but will edit/add whatever I will discover, time to time.

This is ACHAL RASTOGI, pursuing Masters in Bioinformatics from Jamia Millia Islamia, New Delhi. My interests are Genomics, Proteomics, Drug & Vaccine Designing, algorithm developments, Database developments. I want to achieve many things in life by my complete dedication and loyalty towards my work. For more, please visit about me.

email id: achal13rastogi@gmail.com.